View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8399_low_6 (Length: 229)
Name: NF8399_low_6
Description: NF8399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8399_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 81 - 215
Target Start/End: Original strand, 3688983 - 3689123
Alignment:
| Q |
81 |
aagtttatgatattctacagagtttgaatgattgtaaccaagggaaaaggctatagatat------atatatttaattagatcaggtaatcaaaatgata |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
3688983 |
aagtttatgatattctacagagtttgaatgattgtaaccaagggaaaaggctatagatatgtatatatatatttaatttgatcaggtaatcaaaatgata |
3689082 |
T |
|
| Q |
175 |
ataaggatgatggtatagttcataacttcatatcagatttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3689083 |
ataaggatgatggtatagttcataacttcatatcagatttc |
3689123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University