View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8399_low_7 (Length: 225)
Name: NF8399_low_7
Description: NF8399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8399_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 155
Target Start/End: Original strand, 14213511 - 14213646
Alignment:
| Q |
18 |
catatcatagtcttgagagatgatactgatgaaagaggtaatgtggaggggaagtgtgagccttttgtttgttacttaggtgtagaagatatatatataa |
117 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14213511 |
catatcatagtcttgaga--tgatgttgatgaaagaggtaatgtggaggggaagtgtgagccttttgtttgttacttaggtgtagaagatatatatataa |
14213608 |
T |
 |
| Q |
118 |
tgcaggtctgtttgttgcatattatataaatagataaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14213609 |
tgcaggtctgtttgttgcatattatataaatagataaa |
14213646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University