View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8401_low_3 (Length: 247)
Name: NF8401_low_3
Description: NF8401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8401_low_3 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 247
Target Start/End: Original strand, 2975529 - 2975763
Alignment:
| Q |
13 |
tggacatcagatgggcaatacgttgcctcccagtgttttctgaaaggaactggcaattggactttttaccatgcaggtgatttcacagttgaggatggga |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2975529 |
tggacttcagatgggcaatacgttgcctcccagtgttttctgaaaggaactggcaattggactttttaccatgcaggtgatttcacagttgaggatggga |
2975628 |
T |
 |
| Q |
113 |
attcatcgaccaaagtcaaattctctatgactcaaattgattgcacgcacactaaaggtggtctgtgtttggattctgcttttatttacccaagcgaatt |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2975629 |
attcatcaaccaaagtcaaattctctatgactcaaattgattgcacgcacactaaaggtggtctgtgtttggattctgcttttatttacccaagcgaatt |
2975728 |
T |
 |
| Q |
213 |
caaaaagagcaagtcatttttaaactgctcctaac |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2975729 |
caaaaagagcaagtcatttttaaactgctcctaac |
2975763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 190
Target Start/End: Complemental strand, 42589955 - 42589889
Alignment:
| Q |
124 |
aaagtcaaattctctatgactcaaattgattgcacgcacactaaaggtggtctgtgtttggattctg |
190 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| || |||||||||||||| ||||| ||||||| |
|
|
| T |
42589955 |
aaagtaaaattttctatgactcaaattgattgcacacatactaaaggtggtctctgtttagattctg |
42589889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University