View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8402_low_12 (Length: 287)
Name: NF8402_low_12
Description: NF8402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8402_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 12 - 269
Target Start/End: Original strand, 349576 - 349833
Alignment:
| Q |
12 |
tctctttattttcgagcagtttatagaggccgtaaccctagaaagttatcattttggtaataacctatttgttttagtctaattctaaataaaagattgt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
349576 |
tctctctattttcgagcagtttatagaggccgtaaccctagaaagttatcattttggtaataacctatttgttttagtctaattctaaataaaagattgt |
349675 |
T |
 |
| Q |
112 |
gcacatgtgcatcatatcaatactatgtttatcttgtcaagtataaaagcttattaattaagaataatttgtgattagtccttgagtgtctacaattaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
349676 |
gcacatgtgcatcatatcaatactatgtttatcttgtcaagtataaaagcttattaattaagaataatttgtgattagtccttgagtgtctacaattaat |
349775 |
T |
 |
| Q |
212 |
gttggttgataaaatgaaagagactactcgtaaaattaccaggttgatttgcaagttc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
349776 |
gttggttgataaaatgaaagagactactcgtaaaattaccaggttgatttgcaagttc |
349833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University