View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8403_high_26 (Length: 300)
Name: NF8403_high_26
Description: NF8403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8403_high_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 161 - 300
Target Start/End: Original strand, 10285884 - 10286023
Alignment:
| Q |
161 |
catgttatcaatggtgaagtctttggatattctgaaaacaccttcttctgtcaaaatcatcactctcacaatcttctctctaacccttctcatcttcctc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10285884 |
catgttatcaatggtgaagtctttggatattctgaaaacaccttcttctgtcaaaatcatcactctcacaatcttctctctaacccttctcatcttcctc |
10285983 |
T |
 |
| Q |
261 |
ttcactcgttactcatcttcaaccaccactatctcttccc |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10285984 |
ttcactcgttactcctcttcaaccaccactatctcttccc |
10286023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 55 - 138
Target Start/End: Complemental strand, 28265912 - 28265829
Alignment:
| Q |
55 |
ctgaaccgattattccatcaaatatctcaggaaatgacgagtaagctaagaacttcaaaatatctgttatcacttaattcaaca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265912 |
ctgaaccgattattccatcaaatatctcaggaaatgacgagtaagctaagaacttcaaaatatctgttatcacttaattcaaca |
28265829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University