View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8403_low_19 (Length: 402)
Name: NF8403_low_19
Description: NF8403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8403_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 9 - 384
Target Start/End: Complemental strand, 32605798 - 32605423
Alignment:
| Q |
9 |
gatgaagagagaatgccgagtgagttaggagatacgatttgaatgtgagtgagatttgaaagagtgagagcttgatgaagtgcattcatggccggaagaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32605798 |
gatgaagagagaatgccgagtgagttaggagatacaatttgaatgtgagtgagatttgaaagagtgagagcttgatgaagtgcattcatggcaggaagaa |
32605699 |
T |
|
| Q |
109 |
tgtgtgctattaaggttttgtctgaagttgcgaggatttcgttaccgacggcgatacggttgaagatggttttggggtggaaagggaggatgttggtggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605698 |
tgtgtgctattaaggttttgtctgaagttgcgaggatttcgttaccgacggcgatacggttgaagatggttttggggtggaaagggaggatgttggtggt |
32605599 |
T |
|
| Q |
209 |
gatccatttttgagcggaggggagttttgtgagggaagggatgtcggcgttggagacagttacggtgacggagatgtttgtattggcgaaggcacgaagg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32605598 |
gatccatttttgagcggaggggagttttgtgagggaagggatgtcggcgttggagacagttacggtgacggagatgtttgtattggcgaaggcacggagg |
32605499 |
T |
|
| Q |
309 |
atggaagagtttgtgtcgaagattttaatgtgggtgattgtggtttgggttttgaggaaagtggcgacggttgtgg |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605498 |
atggaagagtttgtgtcgaagattttaatgtgggtgattgtggtttgggttttgaggaaagtggcgacggttgtgg |
32605423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University