View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8403_low_42 (Length: 212)
Name: NF8403_low_42
Description: NF8403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8403_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 48 - 200
Target Start/End: Original strand, 52711186 - 52711342
Alignment:
| Q |
48 |
agtttgtgccggccagcctacattatttgttacagccataaatcaattgtaacccaaataaaaatgatg----accttgcctgattgagacgctttcttc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52711186 |
agtttgtgccggccagcctacattatttgttacagccataaatcaattgtaacccaaataaaaatgatggatgaccttgcctgattgagacgctttctta |
52711285 |
T |
|
| Q |
144 |
cactctgctaacctatataaaatgcaaaattagtgttacttttcatttcatctcact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52711286 |
cactctgctaacctatataaaatgcaaaattagtgttacttttcatttcatctcact |
52711342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 48 - 200
Target Start/End: Original strand, 52720054 - 52720203
Alignment:
| Q |
48 |
agtttgtgccggccagcctacattatttgttacagccataaatcaattgtaacccaaataaaaatgatgaccttgcctgattgagacgctttcttccact |
147 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
52720054 |
agtttgtgccagccagcctacattatttgttacagccataaatcaactgtaacccaaataaaaatga---ccctgcctgatcgagacgctttcttccact |
52720150 |
T |
|
| Q |
148 |
ctgctaacctatataaaatgcaaaattagtgttacttttcatttcatctcact |
200 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52720151 |
ctgctaacatatataaaatgtaaaattagtgttacttttcatttcatctcact |
52720203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University