View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8404_high_4 (Length: 404)
Name: NF8404_high_4
Description: NF8404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8404_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 306
Target Start/End: Original strand, 29125867 - 29126164
Alignment:
| Q |
19 |
ctttgcccactgataagttttaagtggatcaactta----ttttcattaacaacctttgtacttcgttaaaattgttgtattttatctatctatctgtca |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29125867 |
ctttgcccaccgataagttttaagtggatcaacttaattattttcattaacaacctttgtacttcgttaaaattgttgtattttatctatctatctgtca |
29125966 |
T |
 |
| Q |
115 |
caacttgacgtgcaagaaatgattttgtttttcaaggagtctcgtggaatgattgactacttttagggtcctacgtccaagctgcatgctcctaccactc |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29125967 |
caacttgacgtgcaagaaatgattttatttttcaaggagtctcgtggaatgattgactacttttagggtcctacgtccaagctgcatgctcctac----- |
29126061 |
T |
 |
| Q |
215 |
ctcatgcggatgttgatgaaaattctctt-------------gggcgggcaatcagagagactacggtggcatcttgcgtaacaacaaaaccaagtgact |
301 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29126062 |
--catgcggatgttgatgaaaattctcttgacaatatatatagggcgggcaatcagagagactacggtggcatcttgcgtaacaacaaaaccaagtgact |
29126159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 327 - 355
Target Start/End: Original strand, 29126162 - 29126190
Alignment:
| Q |
327 |
tgttgagtgagatatcaactcttcaaatc |
355 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29126162 |
tgttgagtgagatatcaactcttcaaatc |
29126190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University