View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8404_low_10 (Length: 252)
Name: NF8404_low_10
Description: NF8404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8404_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 49157005 - 49156861
Alignment:
| Q |
1 |
ataattttggagagtgatcaaacatattcttttggtcaattttattttatgctagtaatttaatcgtat-annnnnnnnaattatctaccatatactcca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
49157005 |
ataattttggagagtgatcaaacatattcttttggtcaattttattttatgctagtaatttaatcgtataattttttttaattatctaccatatactcca |
49156906 |
T |
|
| Q |
100 |
aaattattattcattatt-acatattaaattaaatttcacggtgt |
143 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49156905 |
aaattattattcattattaacatattaaattaaatttcacggtgt |
49156861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University