View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8404_low_5 (Length: 335)
Name: NF8404_low_5
Description: NF8404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8404_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 173 - 317
Target Start/End: Original strand, 43178661 - 43178809
Alignment:
| Q |
173 |
tgaggagaattgaagatcttgagatgagcacactccacttcaagttttcaaaccaacgccgtcagatcaaccaattggattgaaaaatacaag----tat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||| |||||||||||||||||| || |
|
|
| T |
43178661 |
tgaggagaattgaagatcttgagatgagcacactccactccaagttttcaaaccaacgccaccggatcaaccaagtggattgaaaaatacaaggattaat |
43178760 |
T |
 |
| Q |
269 |
taatgtgggtgtattttttgtcgaaattgaaattttcaaagaaaattgt |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43178761 |
taatgtggatgtattttttgtcgaaattgaaattttcaaagaaaattgt |
43178809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 12 - 104
Target Start/End: Original strand, 43176942 - 43177034
Alignment:
| Q |
12 |
agattattctacggatttcaaagatatactccgtacctgtcctttttgttcagtgaagaccgattcaattgagaatctcaatcattgaaatct |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43176942 |
agatcattctacggatttcaaagatatactccgtacctgtcctttttcttcagtgaagaccgattcaattgagaatctcaatcattgatatct |
43177034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University