View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8405_low_5 (Length: 330)
Name: NF8405_low_5
Description: NF8405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8405_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 15 - 314
Target Start/End: Complemental strand, 40676419 - 40676120
Alignment:
| Q |
15 |
tggaatcgcaacccaagtgactatctgaaattggagggtccaacaaaatcaaatgttatactgttattacagtgatatactaatttacagttaaatgttc |
114 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40676419 |
tggaatcacaacccaaatgactatctgaaattggagggtccaacaaaatcaaatgttatactgttattacagtgatatactaatttacagttaaatgttc |
40676320 |
T |
 |
| Q |
115 |
ttgctgctcaataactaaaaaactgaatcagcagattagtcaccgaaactgtaagtatgattgaaataatttctcaatttttctaattggcatatacatt |
214 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40676319 |
ttgctgctcaatacctaaaaaaatgaatcagcagattagtcaccgaaactgtaagtatgattgaaataatttctcaatttttcgaattggcatatacatt |
40676220 |
T |
 |
| Q |
215 |
ttagaaattgtaaaatgtcacgcaaaatgtccctcacttagcttctgttattaagagggtgtgacgtgtcatgttgcacatcgatctcacataatgttat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40676219 |
ttagaaattgtaaaatgtcacgcaaaatgtccctcacttagcttttgttattaagagggtgtgacgtgtcatattgcacatcgatctcacataatgttat |
40676120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University