View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8406_high_9 (Length: 236)
Name: NF8406_high_9
Description: NF8406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8406_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 13140201 - 13139985
Alignment:
| Q |
7 |
atgtgcttatgactcaaggcaattttcgaaagaaatcatgggaatgagtgttttggccatgactgtaattgtgatctgtttgccagaaccaaggggtctt |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140201 |
atgtgcttatgactcaaggcatttttcgaaagaaatcatgggaatgagtgttttggccatgattgtaattgtgatctgtttgccagaaccaaggggtctt |
13140102 |
T |
|
| Q |
107 |
tctgtggaaaccttcacgagcaatcgttgttttttgatggtttttctgcttctcatcgctgctctttccacacctccggatatctgatgccaaatcgtcg |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140101 |
tctgtggaaaccttcacgaacaatcgttgttttttgatggtttttccgcttctcaccgctgctctttccacacctccggatatctgatgccaaatcgtcg |
13140002 |
T |
|
| Q |
207 |
cctgtttcctaatttct |
223 |
Q |
| |
|
| |||||||| |||||| |
|
|
| T |
13140001 |
catgtttccttatttct |
13139985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University