View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8406_low_2 (Length: 431)
Name: NF8406_low_2
Description: NF8406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8406_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 15 - 421
Target Start/End: Original strand, 41171439 - 41171835
Alignment:
| Q |
15 |
aaagagatgggtaattttgactactattcttcggtagtttttgctcattttggagtgggcccctcaatacacccttagttcttgaaatcagaccttattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171439 |
aaagagatgggtaattttgactactattcttcggtagtttttgctcattttggagtgggcccctcaatacacccttagttcttgaaatcagaccttattg |
41171538 |
T |
 |
| Q |
115 |
ctgggaccaccac-atattgctactttgactattcagcaaggtgcaattgtatctaattttaggttatgcagatatttcgaaagtgtggttataatgtgg |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171539 |
ctgggaccaccactatattgctactttgactattcagcaaggtgcaattgtatctaattttaggttatgcagatatttcgaaagtgtggttataatgtgg |
41171638 |
T |
 |
| Q |
214 |
attaccatgcactatcttgagttttcattgcaacattcattttcttgattggatatgtaggacaacaaatttcctctcaaatcaatactgaatatttaat |
313 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171639 |
atcaccatgcactatcttgagttttcattgcaacattcattttcttgattggatatgtaggacaacaaatttcctctcaaatcaatactgaatatttaat |
41171738 |
T |
 |
| Q |
314 |
ttacaaatgataacaataatcatattacttattaggtatagactaattttacttatgcgtattgcatccataccgcttatacataccagcttcataaacc |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171739 |
ttacaaatgataacaataatcatattacttattaggtatagactaattttactt-----------atccataccgcttatacataccagcttcataaacc |
41171827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 55 - 126
Target Start/End: Complemental strand, 38221340 - 38221268
Alignment:
| Q |
55 |
ttgctcattttggagtgggcccctcaatacaccctt-agttcttgaaatcagaccttattgctgggaccacca |
126 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38221340 |
ttgcccatcttggagtgggccccacaatacacccttcagttcttgaaatcagaccttattgctgggatcacca |
38221268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University