View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8407_high_13 (Length: 269)
Name: NF8407_high_13
Description: NF8407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8407_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 4365688 - 4365925
Alignment:
| Q |
19 |
catacgatgtctgaaaattttctagattttattgaaggtattcagctaacctatgaagtatgaacatgatgcaattggtcccgtctaaaaatattgttcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4365688 |
catacgatgtctgaaaattttctagattttattgaaggtattcagctaacctatgaagtatgaacatgatgcaattggtcccgtctaaaaatattgttcc |
4365787 |
T |
 |
| Q |
119 |
aagaatttatgaaaaatcacacactgaacatgttttatgcagtagttttcatgctttctctagttcatctaaataagtatctttctttctttttaagcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4365788 |
aagaatttatgaaaaatcacacactgaacatgttttgtgcagtagttttcaggctttctctagttcatctaaacaagtatctttctttctttttaagcat |
4365887 |
T |
 |
| Q |
219 |
gtacaaagttcatatccggaaccaaacttcaagttcat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4365888 |
gtacaaagttcatatccggaaccaaacttcaagttcat |
4365925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University