View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8407_low_11 (Length: 353)
Name: NF8407_low_11
Description: NF8407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8407_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 6987043 - 6987170
Alignment:
| Q |
1 |
aaatgaaagaagtaaaacacatatgactcaaatcactccatgattcattttcactctcttcactatcacacaacacagcactcattgctgttgcgtgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6987043 |
aaatgaaagaagtaaaacacatatgactcaaatcactccatgattcattttcactctcttcactatcacacaacacagcactcattgctgttgcgtgtgt |
6987142 |
T |
|
| Q |
101 |
aacttccttcaaccaccgccatgccaat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6987143 |
aacttccttcaaccaccgccatgccaat |
6987170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 232 - 353
Target Start/End: Original strand, 6987283 - 6987404
Alignment:
| Q |
232 |
gctaccattgctttcatccttcaatggcgtggtggtatcaccgatccagcgacccttttgtcacctcatggcgctcataacttccctggcatggattctt |
331 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6987283 |
gctaccattgctttcatccttcaaaggcgtggtggtatcaccgatccagcgacccttttgtcacctcatggcgctcataacttccctggcatggattctt |
6987382 |
T |
|
| Q |
332 |
ctcctctttcacctcttactca |
353 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
6987383 |
ctcctctttcacctctaactca |
6987404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University