View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8407_low_12 (Length: 333)
Name: NF8407_low_12
Description: NF8407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8407_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 315
Target Start/End: Complemental strand, 26913549 - 26913254
Alignment:
| Q |
24 |
aataggagtgtacaatagtgtgtgtgtatatgtgtatatatacacacacataaatacaagatgatttgtacgtattactaaattatgagtacttgactaa |
123 |
Q |
| |
|
||||||||| ||||||||||||| ||||| ||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26913549 |
aataggagtctacaatagtgtgtatgtatgtgtgtgtatatacacaca--tagatacaagatgatttgtacgtattactaaattatgagtacttaactaa |
26913452 |
T |
|
| Q |
124 |
attgtactactcgctgattacttgtactatacgct--acttgtctcattcttattggatgtgctttgctcatggtgtaatattggtttgatgcttggggt |
221 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
26913451 |
actgtactactcgctaattacttgtactatacgctacacttgtctcattcttattggatgtgctttgctcatggtgtaatattggtttgatggttggagt |
26913352 |
T |
|
| Q |
222 |
---gtgattttctgaaatctcatattcgattgttttggtggtttcttgaag-gnnnnnnngtatgataaaaatcccaaaaatttattttcgaatattt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26913351 |
gtggtgattttctgaaatctcatattcgattgttttggtggtttcttgaagaaaaaaaaagtatgataaaaatcccaaaaaattattttcgaatattt |
26913254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 119 - 190
Target Start/End: Original strand, 13395949 - 13396022
Alignment:
| Q |
119 |
actaaattgtactactcgctgattacttgtactatacgct--acttgtctcattcttattggatgtgctttgct |
190 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |||||||| ||| |||| |||||||||||| |
|
|
| T |
13395949 |
actaaattgtactactcactaattacttgtactatacgctacacttgtctttttcgtatttaatgtgctttgct |
13396022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University