View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8407_low_13 (Length: 327)
Name: NF8407_low_13
Description: NF8407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8407_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 7985354 - 7985596
Alignment:
| Q |
1 |
agcaatataccagctctagtaatacgaagaccaaattcaaggatgattctgcaaagatcacagccaagaccagctttatcaggacaattgacagtgacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7985354 |
agcaatataccagctctagtaatacgaagaccaaattcaaggatgattctgcaaagatcacagccaagaccagctttatcaggacaattgacagtgacaa |
7985453 |
T |
 |
| Q |
101 |
tggttggttcatttgcattcttggcatgctggatcacaacgaggtcgtctgatggtatccccatcactgagaaacggtgaattcagtggttggataatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7985454 |
tggttggttcatttgcattcttggcatgctggatcacaacgaggtcgtctgatggtatccccatcactgagaaacggtgaattcagtggttggataatag |
7985553 |
T |
 |
| Q |
201 |
cattgccggagctccggcgaaggttgctccggcgaatggtttg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7985554 |
cattgccggagctccggcgaaggttgctccggcgaatggtttg |
7985596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 268 - 304
Target Start/End: Original strand, 7985615 - 7985651
Alignment:
| Q |
268 |
cagagtgtgaaataatgtttgatattttatatagtag |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7985615 |
cagagtgtgaaataatgtttgatattttatatagtag |
7985651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University