View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8407_low_7 (Length: 413)
Name: NF8407_low_7
Description: NF8407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8407_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 85 - 407
Target Start/End: Original strand, 15985697 - 15986019
Alignment:
| Q |
85 |
aggcagcaaactgaacaacgtgtttggattgtgtggtagtaaaagataagctgctaagaagccatggccggtgtctgctctttcttctctaccacttcct |
184 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15985697 |
aggcagcaaactgaacaacgtgtttgtattatgtggtagtaaaagataagctgctaagaagccatggccggtgtctgctctttcttctctaccacttcct |
15985796 |
T |
|
| Q |
185 |
ccgacgttgttgccatttctcattctcttacaccatcactgtctctcaacaacactacattttcaacaacaagtaaaagaagatgcattctgaggaggac |
284 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15985797 |
ctgacgttgttgccatttcacattctcttacaccatcactgtctctcaacaacactacactttcaacaacaagtaaaagaagatgcattctgaggaggac |
15985896 |
T |
|
| Q |
285 |
gagaactgtgaggcctcttgtttgtgcagccatcaacaatccattacaataccggaaacttggtgactctgaccttaatatcagtgaaatcactcttggt |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15985897 |
gagaactgtgaggcctcttgtttgtgcagccatcaacaatccattacaataccggaaacttggtgactctgaccttaatatcagtgaaatcactcttggt |
15985996 |
T |
|
| Q |
385 |
actgtaagtttacttcttctcac |
407 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15985997 |
actgtaagtttacttcttctcac |
15986019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University