View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8407_low_8 (Length: 393)
Name: NF8407_low_8
Description: NF8407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8407_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 29464211 - 29464578
Alignment:
| Q |
1 |
tagtcatgttacccaaactacggtttataagttatagccatgcattggtgtttttccttttcaccaattatcaaattccatgaatattgattgccaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464211 |
tagtcatgttacccaaactacggtttataagttatagccatgcattggtgtttttccttttcaccaattatcaaattccatgaatattgattgccaaaac |
29464310 |
T |
|
| Q |
101 |
acactttaaagccccatggcccatgctggggaccatggtttttgtcttctcatttgcactataatggaatttgaccttttcacctaatcatcacatatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464311 |
acactttaaagccccatggcccatgctggggaccatggtttttgtcttctcatttgcactataatggaatttgaccttttcacctaatcatcacatatca |
29464410 |
T |
|
| Q |
201 |
taaatggttgagtgttgcataatctatcatgcttatcatccagtgttagatgaaattaaaatcatattagcatcatcattaatcacaagataaaaaagga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464411 |
taaatggttgagtgttgcataatctatcatgcttatcatccagtgttagatgaaattaaaatcatattagcatcatcattaatcacaagataaaaaagga |
29464510 |
T |
|
| Q |
301 |
gtaacaaagtttaatcaataatacaattatccatatgcaatttgctagttgatacataacttttcagg |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464511 |
gtaacaaagtttaatcaataatacaattatccatatgcaatttgctagttgatacataacttttcagg |
29464578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University