View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8408_low_1 (Length: 220)
Name: NF8408_low_1
Description: NF8408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8408_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 8796987 - 8796798
Alignment:
| Q |
19 |
gtgtaattaatttctttgtacnnnnnnngtttgacaagtttggatctgatgagctgtgttgtataattgtactttgaaactgtggccttttgttttcatt |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8796987 |
gtgtaattaatttctttgtactttttttgtttgacaagtttggatctgatgagctgtgttgtataattgtactttgaaactgtggccttttgttttcatt |
8796888 |
T |
 |
| Q |
119 |
tccatttattactaatattgacaaactatcatgtatattattgtaagtcaaaacccttttaagcatagatgataaagacacttcatctca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8796887 |
tccatttattactaatattgacaaactatcatgtatattattgtaagtcaaaacccttttaagcatatgtgataaagacacttcatctca |
8796798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University