View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8408_low_7 (Length: 273)
Name: NF8408_low_7
Description: NF8408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8408_low_7 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 7729156 - 7729395
Alignment:
| Q |
15 |
actcaaaaacgaaggatggctcttggagattttgcacggattacagggctttgaacaccatcactatcaaagacagttctcctataccaatagtggatga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||| |
|
|
| T |
7729156 |
actcaaaaacgaaggatggctcttggagattttgcacggattacagggctttgaacaccatcactatcaaagacagttttcctattccaattgtggatga |
7729255 |
T |
|
| Q |
115 |
aatcttagatgaattgcttggtgcataatatttttctaaacttgaattaaggtctggctaccaccacattctagtcacacctgaggatagacacaagact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7729256 |
aatcttagatgaattgcttggtgcataatatttttctaaacttgaattaaggtctggctaccaccacattctagtcacacctgaggatagacacaagact |
7729355 |
T |
|
| Q |
215 |
tcctttcgaacacatcaaggcctttatgagtggttggtca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7729356 |
tcctttcgaacacatcaaggcctttatgagtggttggtca |
7729395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 159
Target Start/End: Original strand, 42679 - 42809
Alignment:
| Q |
29 |
gatggctcttggagattttgcacggattacagggctttgaacaccatcactatcaaagacagttctcctataccaatagtggatgaaatcttagatgaat |
128 |
Q |
| |
|
||||| |||||||| ||||| || ||||||||||| |||||| | |||||| ||||||| |||| ||| || || | |||||||||| | || |||||| |
|
|
| T |
42679 |
gatgggtcttggaggttttgtactgattacagggcattgaactctatcactgtcaaagatagttttcccattcctacagtggatgaactattggatgaac |
42778 |
T |
|
| Q |
129 |
tgcttggtgcataatatttttctaaacttga |
159 |
Q |
| |
|
| | |||||| | ||||||||||| ||||| |
|
|
| T |
42779 |
tacatggtgcttgctatttttctaagcttga |
42809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University