View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8409_high_10 (Length: 278)
Name: NF8409_high_10
Description: NF8409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8409_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 58 - 213
Target Start/End: Complemental strand, 42374253 - 42374098
Alignment:
| Q |
58 |
ccctccaatccggcaattcaagactcaaatccaactaaaattgtgtttagaatcacggtaaaacaattcttcactgtgcatctggcaaaaagccatgact |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42374253 |
ccctccaatccggcaattcaagactcaaatccaactaaaattgtgtttataatcacggtaaaacaattcttcactgtgcatctggcacaaagccatgact |
42374154 |
T |
 |
| Q |
158 |
tcgtgcagaagttatcacggtttgaattggacacaaacactcacttagtgcaattt |
213 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42374153 |
tcgcgcagaagttatcacggtttgaattggacacaaacactcactcagtgcaattt |
42374098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 211 - 263
Target Start/End: Complemental strand, 42373949 - 42373897
Alignment:
| Q |
211 |
tttatggaaactacggttttaagcttcagaaaatcacagtaagagtgcacagg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42373949 |
tttatggaaactacggttttaagcttcagaaaatcacagtaagagtgcacagg |
42373897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University