View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8409_high_7 (Length: 319)
Name: NF8409_high_7
Description: NF8409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8409_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 154 - 312
Target Start/End: Complemental strand, 43995311 - 43995144
Alignment:
| Q |
154 |
tccagtcacgtattgggtctcaggagtcatatgtagtgtaagctctcaaaatgttgtaaatgtaccatatgcgatatgttaagct---------tagact |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43995311 |
tccagtcacgtattgggtctcaggagtcatatgtagtgtaagctctcaaaatgttgtaaatgtaccatatgcgatatgttaagcttgcgcacactagact |
43995212 |
T |
 |
| Q |
245 |
ttgcccagaaacatactgttcgttgaggcatatgtaaggaaatacttaaattccatatcttcttctca |
312 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43995211 |
ttgcccagaaacacactgttcgttgaagcatatgtaaggaaatacttaaattccatatcttcttctca |
43995144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 43995447 - 43995329
Alignment:
| Q |
19 |
caaattgcaaacacaacaccattttcccaattcacatatgggtttaaacaaatgacggaatacatatcaaaaaagagggatg-------aagctcatggc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43995447 |
caaattgcaaacacaacaccattttcccaattcacatatgggtttaaacaaatgacggaatacatatcaaaaaagagggatgaaggcataagctcatggc |
43995348 |
T |
 |
| Q |
112 |
aaagagagcggtcaaaaca |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43995347 |
aaagagagcggtcaaaaca |
43995329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 233
Target Start/End: Original strand, 43999040 - 43999073
Alignment:
| Q |
200 |
caaaatgttgtaaatgtaccatatgcgatatgtt |
233 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
43999040 |
caaaatgttgttaatgtaccatatgcgatatgtt |
43999073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University