View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8409_low_17 (Length: 263)
Name: NF8409_low_17
Description: NF8409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8409_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 54997 - 55203
Alignment:
| Q |
1 |
ctttcgaatctttattgataaatttttccagtgcattattgtatattgtagttggaatatcttccatggatttgagtaaatccatgcatgcctccacgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54997 |
ctttcgaatctttattgataaatttttccagtgcattattgtatattgtagttggaatatcttccatggattcgagtaaatccatgcatgcctccacgga |
55096 |
T |
 |
| Q |
101 |
ataacaacctgattgattattttgagctttatagcattctgcttttgctttatattactctgtcatcgcgctcgttaattcagttcatcggcttaaagct |
200 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55097 |
atagcgacctgattgattattttgagctttatagcattctgcttttgctttatattactctgtcatcgcgctcgttaatt---------ggcttaaagct |
55187 |
T |
 |
| Q |
201 |
gcatcgattatctctg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
55188 |
gcatcgattatctctg |
55203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University