View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8410_low_4 (Length: 300)
Name: NF8410_low_4
Description: NF8410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8410_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 25 - 293
Target Start/End: Complemental strand, 6082972 - 6082697
Alignment:
| Q |
25 |
gttgtttatcatcatcatcctgaatagaaaaagg------gaccacaagattattgccttnnnnnnnggaccacaaaattataagtaaacag-ttatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || |||| |
|
|
| T |
6082972 |
gttgtttatcatcatcatcctgaatagaaaaaggtaataggaccacaagattattgcctcaaaaaaaagaccacaaaattataagtaaacaggttttttt |
6082873 |
T |
|
| Q |
118 |
atttgattttgtctagctatagttgtttttcccgtgaaacacttcttgtccataactgaatccgtcgagaacttccgattatgccacacacatacatata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| ||||||| |
|
|
| T |
6082872 |
atttgattttgtctagctatagttgtttttcccgtgaaacacttcttgtccataactgaatccctcaagaacttccgattatgccacccacacacatata |
6082773 |
T |
|
| Q |
218 |
gtctatataggttatttactcaacataatctcaaactctaaatctaaagctcatgttgatttatgtggaacaccaa |
293 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082772 |
gtctatataggttattcactcaacataatctcaaactctaaatctaaagctcatgttgatttatgtggaacaccaa |
6082697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University