View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8410_low_8 (Length: 241)
Name: NF8410_low_8
Description: NF8410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8410_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 39 - 234
Target Start/End: Complemental strand, 13400276 - 13400081
Alignment:
| Q |
39 |
ttaagtcagcattgaagccgaaataatcataattaacaccttagttgatacaaactaaagtattctagaaaaagtttgaatctaacccaaatttcagcat |
138 |
Q |
| |
|
|||| |||||||| ||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13400276 |
ttaattcagcattcaagcccaaataatcaaaattaacaccttagttgatacaaacttaagtattctagaaaaagtttgaatctaacccaaatttcagcat |
13400177 |
T |
 |
| Q |
139 |
gtggttcttggaataatagttgtcgcataagctagttaaaagtgtaccataattgaattagcggtgaacatcaaatcttatacagagggcatgtta |
234 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13400176 |
gtggttcttggaataatagttgtagcataagctagttaaaagtgtaccatatttgaattagcggtgaacatcaaatcttatacagagggcatgtta |
13400081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 13400316 - 13400282
Alignment:
| Q |
17 |
caagccatacttatacttagttttaagtcagcatt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13400316 |
caagccatacttatacttagttttaagtcagcatt |
13400282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University