View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_high_19 (Length: 316)
Name: NF8412_high_19
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 52491266 - 52490972
Alignment:
| Q |
1 |
cgatttcatagaagagtaatacgnnnnnnnttcagatctgcaattgattcatccatgtttcttcttctttcaagcagctgtcgcaagagccgcaaggttc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52491266 |
cgatttcatagaagagtaatacgaaaaaaattcagatctgcaattcattcatccacgtttcttcttctttcaagcagctgtcacaagagccgcaaggttc |
52491167 |
T |
|
| Q |
101 |
atttcacagccccatcaaacgtccgccgtgtgttgattagcgcacctctctctggtgaccttcgttcaaagtacaacgtgcgttctcttcccgttcgtaa |
200 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52491166 |
atttcaccgccccatcaaacgtccgtcgtgtgttgattagcgcacctctctctggtgaccttcgttcaaagtacatcgtgcgttctcttcccgttcgtaa |
52491067 |
T |
|
| Q |
201 |
ggaggatgaagttcaggttgtgagaggaaccttcaaaggacgtgaagggaaggttgtgcaagtttatcgcaggaaatgggtgattcattatgcaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52491066 |
ggaggatgaagttcaggttgtgagaggaaccttcaagggacgtgaagggaaggttgtgcaagtttatcgcaggaaatgggtgattcattatgcaa |
52490972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 164 - 288
Target Start/End: Original strand, 2468499 - 2468618
Alignment:
| Q |
164 |
gttcaaagtacaacgtgcgttctcttcccgttcgtaaggaggatgaagttcaggttgtgagaggaaccttcaaaggacgtgaagggaaggttgtgcaagt |
263 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||| ||||| ||| ||||||| || ||||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
2468499 |
gttcaaagtacaacatgcgttctcatcctgttcgcaaggatgattaagttca-----tgggaggaaccttcaagggacgtgaaggggagattgtgcaagt |
2468593 |
T |
|
| Q |
264 |
ttatcgcaggaaatgggtgattcat |
288 |
Q |
| |
|
|||| | |||||||||||||||||| |
|
|
| T |
2468594 |
ttattgaaggaaatgggtgattcat |
2468618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 68 - 288
Target Start/End: Original strand, 5404205 - 5404425
Alignment:
| Q |
68 |
tttcaagcagctgtcgcaagagccgcaaggttcatttcacagccccatcaaacgtccgccgtgtgttgattagcgcacctctctctggtgaccttcgttc |
167 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||| |||||||||| |||||| ||||||||||| ||||||||||| || |||||||| ||||| |
|
|
| T |
5404205 |
tttcaagcagccgtcgcaagagccgcaaggctcatttcaccgccccatcaagcgtccgtcgtgtgttgatgagcgcacctctttccggtgacctccgttc |
5404304 |
T |
|
| Q |
168 |
aaagtacaacgtgcgttctcttcccgttcgtaaggaggatgaagttcaggttgtgagaggaaccttcaaaggacgtgaagggaaggttgtgcaagtttat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5404305 |
aaagtacaacgtgcgttctcttcccgttcgcaaagatgatgaagtgcaggttgtgagaggaaccttcaagggacgtgaagggaaggttgtgcaagtttat |
5404404 |
T |
|
| Q |
268 |
cgcaggaaatgggtgattcat |
288 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5404405 |
cgcaggaaatgggtgattcat |
5404425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 68 - 288
Target Start/End: Complemental strand, 42219925 - 42219705
Alignment:
| Q |
68 |
tttcaagcagctgtcgcaagagccgcaaggttcatttcacagccccatcaaacgtccgccgtgtgttgattagcgcacctctctctggtgaccttcgttc |
167 |
Q |
| |
|
||||||||||| | || ||||| || |||| |||||||| |||||||||| ||||||||||| | || |||||||| ||||| || || || || |
|
|
| T |
42219925 |
tttcaagcagccgccgaaagagtcgaaaggcgcatttcacggccccatcaagtctccgccgtgtgataatgagcgcaccactctccaccgatctccgatc |
42219826 |
T |
|
| Q |
168 |
aaagtacaacgtgcgttctcttcccgttcgtaaggaggatgaagttcaggttgtgagaggaaccttcaaaggacgtgaagggaaggttgtgcaagtttat |
267 |
Q |
| |
|
|| |||||||| ||||| | || ||||| || || ||||||||||| || || |||||||| |||||||| |||||||| || | || ||||||||| |
|
|
| T |
42219825 |
caaatacaacgtccgttccataccagttcgcaaagacgatgaagttcaagtcgttagaggaacattcaaaggccgtgaaggtaaaatcgttcaagtttat |
42219726 |
T |
|
| Q |
268 |
cgcaggaaatgggtgattcat |
288 |
Q |
| |
|
|||| |||||||| |||||| |
|
|
| T |
42219725 |
cgcaaaaaatgggttattcat |
42219705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 31 - 223
Target Start/End: Complemental strand, 30927232 - 30927048
Alignment:
| Q |
31 |
ttcagatctgcaattgattcatccatgtttcttcttctttcaagcagctgtcgcaagagccgcaaggttcatttcacagccccatcaaacgtccgccgtg |
130 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||| | |||| |||||||||||||| ||| ||||| ||||| |||| |
|
|
| T |
30927232 |
ttcagatatgcaattcattcatccatgtttcttcttctttcaagcaaccgtcggaagagccgcaaggtgaccttctt-------tcaaa-gtccgtcgtg |
30927141 |
T |
|
| Q |
131 |
tgttgattagcgcacctctctctggtgaccttcgttcaaagtacaacgtgcgttctcttcccgttcgtaaggaggatgaagttcaggttgtga |
223 |
Q |
| |
|
||||||| |||| ||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30927140 |
tgttgatgagcgaacctctctccggtgaccttctttcaaagtacaacgtgcattctcttcccgttcgtaaggaggatgaagttcaggttgtga |
30927048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 240 - 288
Target Start/End: Complemental strand, 26365376 - 26365328
Alignment:
| Q |
240 |
acgtgaagggaaggttgtgcaagtttatcgcaggaaatgggtgattcat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
26365376 |
acgtgaagggaaggttgtgcaagtttatggcaggaaatggatgattcat |
26365328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 9e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 31 - 137
Target Start/End: Original strand, 21946198 - 21946304
Alignment:
| Q |
31 |
ttcagatctgcaattgattcatccatgtttcttcttctttcaagcagctgtcgcaagagccgcaaggttcatttcacagccccatcaaacgtccgccgtg |
130 |
Q |
| |
|
||||||| ||||||| ||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||| || ||| || |||||||||| |||| |
|
|
| T |
21946198 |
ttcagatatgcaattcattcagccatgtttcttcttctttcaagcatccgtcgcaagagccgcaaggttcattttaccgccacaccaaacgtccgtcgtg |
21946297 |
T |
|
| Q |
131 |
tgttgat |
137 |
Q |
| |
|
||||||| |
|
|
| T |
21946298 |
tgttgat |
21946304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 240 - 288
Target Start/End: Original strand, 45229096 - 45229144
Alignment:
| Q |
240 |
acgtgaagggaaggttgtgcaagtttatcgcaggaaatgggtgattcat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45229096 |
acgtgaagggaaggttgtgcaagtttatggcaggaaatgggtgattcat |
45229144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 85 - 255
Target Start/End: Complemental strand, 3085630 - 3085460
Alignment:
| Q |
85 |
aagagccgcaaggttcatttcacagccccatcaaacgtccgccgtgtgttgattagcgcacctctctctggtgaccttcgttcaaagtacaacgtgcgtt |
184 |
Q |
| |
|
|||||||| |||| ||||||||| || ||||||| |||||||||||| || || |||||||| ||||| | || || || || ||||||||||| |||| |
|
|
| T |
3085630 |
aagagccgtaaggctcatttcacggcgccatcaagcgtccgccgtgtcttaatgagcgcaccactctccgccgatctccgatccaagtacaacgtccgtt |
3085531 |
T |
|
| Q |
185 |
ctcttcccgttcgtaaggaggatgaagttcaggttgtgagaggaaccttcaaaggacgtgaagggaaggtt |
255 |
Q |
| |
|
| | || ||||| || || || |||||||||||||| | ||||| |||||||| |||||||| |||||| |
|
|
| T |
3085530 |
caatgcctgttcgcaaagacgacgaagttcaggttgttcgtggaacattcaaaggccgtgaaggtaaggtt |
3085460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University