View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_high_20 (Length: 313)
Name: NF8412_high_20
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 47927097 - 47926865
Alignment:
| Q |
1 |
gtgtgctgtcatggatggtggagggtctgaaagagaccatttggtagccatcgaagcccttattttgtgtgtagctgaagttggcagcatttgcaattag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
47927097 |
gtgtgctgtcatggatggtggagggtctgaaagagaccatttggtagccatcggagcccttattttgtgtgtagctgaagttggcagcatctgcaatgag |
47926998 |
T |
|
| Q |
101 |
gaaggtagatccaaaatccacatttgtgggactcttgtcgcttttttaaagtttgattggaggaggttttgatgggatcgatcggattagttttatgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47926997 |
gaaggtagatccaaaatccacatttgtgggactcttgtcgcttttttaaagtttgattggaggaggttttgatgggatcgatcggattagttttatgttg |
47926898 |
T |
|
| Q |
201 |
tttgaaacagcatcgcatgtgctattgtgcgaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47926897 |
tttgaaacagcatcgcatgtgctattgtgcgaa |
47926865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University