View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_high_23 (Length: 261)
Name: NF8412_high_23
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 18238037 - 18237794
Alignment:
| Q |
1 |
tatgtttttgtgtcgcaagaaatccttcccaatcatttttat--gtctcttaaatatgttgatgtgttgtacttgttcctttatcttcctgagttaatca |
98 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18238037 |
tatgtttttgtgtcacaagaaatccttcccaatcatttttatatgtctcttaaatatgttgatgtgttgtacttgttcctttatcttactgagttaatca |
18237938 |
T |
 |
| Q |
99 |
atggaccttagcccactaaatatatcatgttttcccccaattaaacctttcattacctttatttagctttacatgctatagaaaggcaataacagcaaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18237937 |
atggaccttagcccactaaatatatcatgttttcccccaattaaacctttcattacctttatttagctttacat-ctatagaaaggcaataacagcaaaa |
18237839 |
T |
 |
| Q |
199 |
tatagataatattattaaacaatgtcttagtcatataggagataa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18237838 |
tatagataatattattaaacaatgtcttagtcatataggagataa |
18237794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University