View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_high_27 (Length: 248)
Name: NF8412_high_27
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 36067146 - 36067358
Alignment:
| Q |
1 |
aattttcaactcttgaaagttgggattaaagtgtcccttaaaggttcatat----cattggggcactatgttgagttgctactatcatcatcactattat |
96 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36067146 |
aattttcaactcttgaaagttgggtttaaagtgtcccttaaaggttcatatatatcattggggcactatgttgagttgctactatcatcatcactattat |
36067245 |
T |
|
| Q |
97 |
cctcttcaacaaaaagttcatcagcagcatcattatcatcatcgacaacaggttcttcgttatacaaacgcggattagcaggtagagccaatatatagct |
196 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36067246 |
cctcttcaacaacaagttcatcagcaacatcattatcatcatcgacaacaggttcttcattatacaaacgcggattagcaggtagagccaatatatagct |
36067345 |
T |
|
| Q |
197 |
tcgagcaacaaaa |
209 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36067346 |
tcgagcaacaaaa |
36067358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 11 - 139
Target Start/End: Original strand, 29024496 - 29024622
Alignment:
| Q |
11 |
tcttgaaagttgggattaaagtgtcccttaaaggttcatatcattggggcactatgttgagttgctactatcatcatcactattatcctcttcaacaaaa |
110 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | ||||||||||||||||||||||||||||| | | ||||||||||||| | |
|
|
| T |
29024496 |
tcttgaaagttgga--taaagtgttccttaaaggttcatatgattgagccactatgttgagttgctactatcatcatccatgtcttcctcttcaacaaca |
29024593 |
T |
|
| Q |
111 |
agttcatcagcagcatcattatcatcatc |
139 |
Q |
| |
|
||||| ||||| |||||||||||||||| |
|
|
| T |
29024594 |
agttcttcagcgacatcattatcatcatc |
29024622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University