View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_high_6 (Length: 544)
Name: NF8412_high_6
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 466 - 526
Target Start/End: Complemental strand, 42438833 - 42438773
Alignment:
| Q |
466 |
ggaggttttggctctaacggcggcattgacggcgtcttcgagcttacgggaaagcatgtat |
526 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42438833 |
ggaggttttggctctaacggcggcattgacggcgtcttcgagtttacgggaaagcatgtat |
42438773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 418 - 450
Target Start/End: Original strand, 42567217 - 42567249
Alignment:
| Q |
418 |
aactcaaaactataataaactctgcattgagaa |
450 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
42567217 |
aactcaaaactataataaactatgcattgagaa |
42567249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 38163517 - 38163468
Alignment:
| Q |
16 |
attattcttgcttataacgcttccaagtccaataaatcacacagttaata |
65 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
38163517 |
attattcttgctagtgacgcttccaagtcctataaatcacactgttaata |
38163468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University