View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_high_9 (Length: 482)
Name: NF8412_high_9
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_high_9 |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 26 - 263
Target Start/End: Original strand, 342763 - 343000
Alignment:
| Q |
26 |
ttggtggtgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342763 |
ttggtggtgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga |
342862 |
T |
 |
| Q |
126 |
ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaagtagcaggtgcaggagttggcgcttgctttgcgggtgca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342863 |
ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaggtagcaggtgcaggagttggcgcttgctttgcgggtgca |
342962 |
T |
 |
| Q |
226 |
ggtgctggcaccggtgttgcctttactggtgcaggggc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342963 |
ggtgctggcaccggtgttgcctttactggtgcaggggc |
343000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 336 - 463
Target Start/End: Original strand, 343058 - 343185
Alignment:
| Q |
336 |
caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343058 |
caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga |
343157 |
T |
 |
| Q |
436 |
gcagatttaggtgccacagttacaggtg |
463 |
Q |
| |
|
|||||||| |||||||| || ||||||| |
|
|
| T |
343158 |
gcagatttgggtgccacggtaacaggtg |
343185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University