View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8412_low_12 (Length: 482)

Name: NF8412_low_12
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8412_low_12
NF8412_low_12
[»] scaffold0002 (2 HSPs)
scaffold0002 (26-263)||(342763-343000)
scaffold0002 (336-463)||(343058-343185)


Alignment Details
Target: scaffold0002 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 26 - 263
Target Start/End: Original strand, 342763 - 343000
Alignment:
26 ttggtggtgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
342763 ttggtggtgcagggggactcttgtgaataacggttggtgctggagctggtgcttgatgtctcctgtgcttgtgtctatgtcttcttctcttgtgcttgga 342862  T
126 ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaagtagcaggtgcaggagttggcgcttgctttgcgggtgca 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
342863 ggactcaggtgctggtacaggtgcttctattgcaggcgttggtgcgggtattggtggtgaggtagcaggtgcaggagttggcgcttgctttgcgggtgca 342962  T
226 ggtgctggcaccggtgttgcctttactggtgcaggggc 263  Q
    ||||||||||||||||||||||||||||||||||||||    
342963 ggtgctggcaccggtgttgcctttactggtgcaggggc 343000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 336 - 463
Target Start/End: Original strand, 343058 - 343185
Alignment:
336 caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga 435  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
343058 caatgttggagttgagacaggtgaactttttggtggttgaggtggtgggacttttgggcttgaagctggtgcaatttttggagctggtgatgtaactgga 343157  T
436 gcagatttaggtgccacagttacaggtg 463  Q
    |||||||| |||||||| || |||||||    
343158 gcagatttgggtgccacggtaacaggtg 343185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University