View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_low_17 (Length: 374)
Name: NF8412_low_17
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 53 - 339
Target Start/End: Original strand, 8247257 - 8247543
Alignment:
| Q |
53 |
ttcattcctccaactatccaaccttttctccaatgtgtagataatcggcttccgagtctccatcttttttgagattgctccaaccgacaacccaaggcaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8247257 |
ttcattcctccaactatccaaccttttctccaatgtgaagataaccggcttccaagtctccatcttttttgagattgctccaaccgacaacccaaggcaa |
8247356 |
T |
 |
| Q |
153 |
gtacacggaagagcacctattatacacttttttaaggaagaagttggaaccaaaaaggagtcaagaaaattaacccctatcaaactacttcttttcgaaa |
252 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8247357 |
gtacacgaaagagcacctattgtacacttttttaaggaagaagttggaaccaaaaaggagtcaagaaaattaacccctatcaaactacttcttttccaaa |
8247456 |
T |
 |
| Q |
253 |
aatttactttatagcccaaaatcaattagacccatctaaaggtggccttcatgcaccataaattttcaacacaaggctcgctaataa |
339 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8247457 |
aatttactttatggcccaaaatcaattagacccatctaaaggtggccttcatgcaccataaattttcaacacaaggctcgctaataa |
8247543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University