View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8412_low_29 (Length: 258)
Name: NF8412_low_29
Description: NF8412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8412_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 77 - 226
Target Start/End: Complemental strand, 5202895 - 5202746
Alignment:
| Q |
77 |
ttgcctggttgttgatgaaggatcgcgggaatcgcagagatgataacttccttcactcattctaccattggtgtagcggtggtgtttggtgaagtttcga |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5202895 |
ttgcctggttgttgatgaaggatcgcgggaatcgcagagatgataacttccttcactcattctaccattggtgtagcggtggtgtttggtgaagtttcga |
5202796 |
T |
|
| Q |
177 |
taccaaattccttgtttgttttgtctttttggtcaaagaaatgttcttga |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5202795 |
taccaaattccttgtttgttttgtctttttggtcaaagaaatgtttttga |
5202746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 5203005 - 5202950
Alignment:
| Q |
1 |
atcatatcacaaaacagatgattaaacaagaaagatgcaatcattgaagaagattt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5203005 |
atcatatcacaaaacagatgattaaacaagaaagatgcaatcattgaagaagattt |
5202950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University