View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8413_high_11 (Length: 254)
Name: NF8413_high_11
Description: NF8413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8413_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 43538201 - 43538427
Alignment:
| Q |
17 |
tttgactcgtttaatcaattgtaaatttggaccatttgatttcaatcgaatggccttcgttgcattgacggcaaagaccgcaatctacaagattctttaa |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538201 |
tttgactcgtttaatcaattgaaaatttggaccatttgatttcaatcgaatggccttcgttgcattgacggcaaagaccgcaatctacaagattctttaa |
43538300 |
T |
|
| Q |
117 |
cggtagggaatctcggtcccatatttgtatgttgtctgtcaaatggttggagttttgacgtgactcatgtcaagtagcaaagctttttgtattaatgaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538301 |
cggtagggaatctcggtcccatatttgtatgttgtctgtcaaatggttggagttttgacgtgactcatgtcaagtagcaaagctttttgtattaatgaag |
43538400 |
T |
|
| Q |
217 |
gtttggatcaattgattcacgcttcat |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43538401 |
gtttggatcaattgattcacgcttcat |
43538427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University