View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8413_high_13 (Length: 249)
Name: NF8413_high_13
Description: NF8413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8413_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 18005768 - 18005539
Alignment:
| Q |
17 |
aaaaatgaccctttgaactccannnnnnnagactaatgtaatttctcaaaagag----------attttatggtgttgagtgtatgtgatgattatgaaa |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18005768 |
aaaaatgaccctttgaactccatttttttagactaatgtaatttctcaaaagagtaagtgggggattttatggtgttgagtgtatgtgatgattatgaaa |
18005669 |
T |
|
| Q |
107 |
tggtcttaatgcattggtgtatttataggaagagattgaaagtaagaagccaaaaggagagagtatcataacaggatatgcttctcagttcacactctta |
206 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18005668 |
tgatcttaatgcattgatgtatttataggaagagattgaaattaagaagccaaaaggacagagtatcataacaggatatgcttctcagttcacactctta |
18005569 |
T |
|
| Q |
207 |
tttgccaatcagtatgtggtttccgtgtgt |
236 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
18005568 |
tttgccaagcagtatgtggtttccgtgtgt |
18005539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 72 - 137
Target Start/End: Complemental strand, 17998352 - 17998287
Alignment:
| Q |
72 |
ttttatggtgttgagtgtatgtgatgattatgaaatggtcttaatgcattggtgtatttataggaa |
137 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
17998352 |
ttttatggtgttgaatgtatgtgacaattatgaaatggttttaatgcattgatgtatttataggaa |
17998287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University