View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8413_low_13 (Length: 301)
Name: NF8413_low_13
Description: NF8413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8413_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 7 - 287
Target Start/End: Complemental strand, 10011063 - 10010783
Alignment:
| Q |
7 |
ttggtgttaaaaggaaagtagttgctgcatgtgcatggaaggtgttcgttttgtttacacctgttcttatttgtttatcttttgtttacatattttccta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10011063 |
ttggtgttaaaaggaaagtagttgctgcatgtgcatggaaggtgttcgttttgtttacacctgttcttatttggttatcttttgtttacatattttccta |
10010964 |
T |
|
| Q |
107 |
ggttcaacaggttttaaaattgtttttctgaatattagagtatctgcgcgttgtgcgtgatggctgttgtcagtgagaacggaatgtttggatttaatgt |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
10010963 |
ggttcaacaggttttaaaattgtttctctgaatattagagtatctgagcgttgtgcgtgacggctgttgtcagtgagaacggaaagtttggatttagtgt |
10010864 |
T |
|
| Q |
207 |
cagtggttgctaattacgttctttaatttgttgatttaatttatgatgttgccatgagtctaatctaatgacattcaagtt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10010863 |
cagtggttgctaattacgttctttaatttgttgatttaatttatgatgttgccatgagtctaatctaatgacattcaagtt |
10010783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University