View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8414_high_10 (Length: 243)
Name: NF8414_high_10
Description: NF8414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8414_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 6524478 - 6524307
Alignment:
| Q |
1 |
gatgcagataaaaatgagcaccacaacagcaacaactggtactactacggcgatgacgacagtagtagtgttgctatttcctgtataaaccaaattcaac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6524478 |
gatgcagataaaaatgagcactacaacagcaacaactggtactactacggcgatgacgacagtagtagtgttgctatttcctgtataaaccaaattcaac |
6524379 |
T |
 |
| Q |
101 |
atgggacattacataacttcaaacaatacaatctgttcaattaaa--aaaattggtttttcatcaattagac |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6524378 |
atgggacattacataacttcaaacaatacaatctgttcaattaaaaaaaaattggtttttcatcaattagac |
6524307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 222
Target Start/End: Complemental strand, 6524286 - 6524255
Alignment:
| Q |
191 |
ccacatggagaggaagtgttaatgctttgcct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6524286 |
ccacatggagaggaagtgttaatgctttgcct |
6524255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University