View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8414_high_9 (Length: 251)
Name: NF8414_high_9
Description: NF8414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8414_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 28342150 - 28342377
Alignment:
| Q |
11 |
tattattcttacttctgatatgtattcctttttcccttgtcttgacccttttgaaaccctcttcacagccacttctaatttgttgnnnnnnncaagtaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28342150 |
tattattcttacttctgatatgtattcctttttcccttgtcttgacccttttgaaaccctcttcacagccacttctaatttgttgtttttttcaagtaaa |
28342249 |
T |
|
| Q |
111 |
cctttgtaaacacctccaaatccaccttctccaagctttcctctttcatcgaaaccatttgttgaattgcttagttctttgtaagtgaacctttttggac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28342250 |
cctttgtaaacacctccaaatccaccttctccaagctttcctttttcatcgaaaccatttgttgaattgcttagttctttgtaagtgaacctttttggac |
28342349 |
T |
|
| Q |
211 |
cagttcctctctcgaattcatcttcatc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28342350 |
cagttcctctctcgaattcatcttcatc |
28342377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University