View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8414_low_10 (Length: 254)
Name: NF8414_low_10
Description: NF8414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8414_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 42 - 240
Target Start/End: Complemental strand, 52053225 - 52053027
Alignment:
| Q |
42 |
agacaataaagtttttctcaaattattatcgatgttgatgtgtttgtaacaatgcttgaaagagaatagagtgaagagaaaccatttacctcgttggttt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52053225 |
agacaataaagtttttctcaaattattatcgatgttgatgtgtttgtaacaatgcttcaaagacaatagagtgaagagaaaccatttacctcgttggttt |
52053126 |
T |
 |
| Q |
142 |
gtggaactaaaagttgtgaaatcatgagaagatgtaggaatggagattgaaagctgagtggtggatgatttatcatccaaatcaagccatgagtttctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52053125 |
gtggaactaaaagttgtgaaatcatgagaagatgtaggaatggagattgaaagctgagtggtggatgatttatcatccaaatcaagccatgagtttctg |
52053027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University