View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8417_high_11 (Length: 336)
Name: NF8417_high_11
Description: NF8417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8417_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 36524079 - 36523842
Alignment:
| Q |
20 |
gggcatgcttctcaacgaatgcttctcttcaacaacaatttgacttaacacctttagaagcttcttcgatgtagatatactgtttttagcttccttaaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36524079 |
gggcatgcttctcaacgaatgcttctcttcaacaacaatttgacttaacacctttagaagcttcttcgatgtagatatactgcttttagcttccttaaga |
36523980 |
T |
|
| Q |
120 |
cggttcttgactccaaccttacatttaccacaattcttcttgtgttttggcttattgctaaccttctgcatttcaacatagtttaacttgatccttctca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36523979 |
cggttcttgactccaaccttacatttaccacaattcttcttgtgttttggcttattgctaaccttctgcatttcaacatagtttaacttgatccttctca |
36523880 |
T |
|
| Q |
220 |
accgtgaccaaaataaataagtatagatgaaatcataa |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36523879 |
accgtgaccaaaataaataagtatagatgaaatcataa |
36523842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 247 - 321
Target Start/End: Complemental strand, 1719063 - 1718989
Alignment:
| Q |
247 |
tgaaatcataaaagaatttaatatctgtggctgttctctgcgcagaggcgtagagggaaactagttttaacaatc |
321 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| ||||| || || ||||||| | |||||| ||||||||| |
|
|
| T |
1719063 |
tgaaaacataaaagaatttaatatctgtggatgttttctgcacacagcagtagaggcatactagtattaacaatc |
1718989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University