View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8417_high_16 (Length: 250)

Name: NF8417_high_16
Description: NF8417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8417_high_16
NF8417_high_16
[»] chr1 (2 HSPs)
chr1 (73-233)||(42717195-42717366)
chr1 (10-45)||(42717366-42717401)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 73 - 233
Target Start/End: Complemental strand, 42717366 - 42717195
Alignment:
73 tcttccatctcgcgacagacttggccaaagaggagtgcactgcccgaatacatgtgtg-------tactgtcaaaacagttgggaaaattaatgacacaa 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||| ||    
42717366 tcttccatctcgcgacagacttggccaaagaggagtgcactgcccgaatacatgtgtgatgtgtgtactgtcaaaacagttgggaaaattaatgacataa 42717267  T
166 annnnnnnagttgcaactcagcagttgaagtttgc----aaagaagtgggatattggaatatcattgaatct 233  Q
    |       |||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||    
42717266 atttttttagttgcaactcagcagttgaagtttgcaaataaagaagtgggatattggaatatcattgaatct 42717195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 42717401 - 42717366
Alignment:
10 agtatggaggttgaatgtgctgaacaaatttaaagt 45  Q
    ||||||||||||||||||||||||||||||||||||    
42717401 agtatggaggttgaatgtgctgaacaaatttaaagt 42717366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University