View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8417_high_19 (Length: 208)
Name: NF8417_high_19
Description: NF8417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8417_high_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 22325458 - 22325266
Alignment:
| Q |
16 |
catatttatattgtttcaactgatggagacataacataactta-ttacatactgagttgttatttactattttcgttttaaaattttgaatgaagaatgg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22325458 |
catatttatattgtttcaactgatggagacataacataacttagttacatactgagttgttatttactattttcgttt-aaaattttgaatgaagaatgg |
22325360 |
T |
 |
| Q |
115 |
agaatctttccgcgctaaaggatttaagcgatataaattttcatccgatggtccattgattcgaggagataaagacacaacaatctatattgat |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22325359 |
agaatctttccgcgctaatggatttaagcgatataaattatcatccgatgatccattgattcgaggagataaagacacaaaaatctatattgat |
22325266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University