View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8417_low_19 (Length: 250)
Name: NF8417_low_19
Description: NF8417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8417_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 73 - 233
Target Start/End: Complemental strand, 42717366 - 42717195
Alignment:
| Q |
73 |
tcttccatctcgcgacagacttggccaaagaggagtgcactgcccgaatacatgtgtg-------tactgtcaaaacagttgggaaaattaatgacacaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
42717366 |
tcttccatctcgcgacagacttggccaaagaggagtgcactgcccgaatacatgtgtgatgtgtgtactgtcaaaacagttgggaaaattaatgacataa |
42717267 |
T |
|
| Q |
166 |
annnnnnnagttgcaactcagcagttgaagtttgc----aaagaagtgggatattggaatatcattgaatct |
233 |
Q |
| |
|
| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42717266 |
atttttttagttgcaactcagcagttgaagtttgcaaataaagaagtgggatattggaatatcattgaatct |
42717195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 42717401 - 42717366
Alignment:
| Q |
10 |
agtatggaggttgaatgtgctgaacaaatttaaagt |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717401 |
agtatggaggttgaatgtgctgaacaaatttaaagt |
42717366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University