View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8417_low_9 (Length: 397)
Name: NF8417_low_9
Description: NF8417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8417_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 3e-61; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 241 - 377
Target Start/End: Complemental strand, 24403763 - 24403623
Alignment:
| Q |
241 |
ctgttatttgtttcattttcaattgtgctgccattctgttcctcatgcttgtgaaatcgatccgatactgcacatgctatcgatgtaccatcatcgtccc |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24403763 |
ctgttatttgtttcattttcaattgtgctgccattctgttcctcatgcttgtgaaatcgatccgatactacacatgctatcgatgtaccatcatcgtccc |
24403664 |
T |
 |
| Q |
341 |
ttgtaaaatggctgcaaa----taaacagaacagtactctt |
377 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24403663 |
ttgtaaaatggctgcaaagccttaaacagaacagtactctt |
24403623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 24404223 - 24404157
Alignment:
| Q |
18 |
tgaagaaccttccatgcttgctctatgaatggttatggaatccaatggacggtcttctaagataggg |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24404223 |
tgaagaaccttccatgcttgctctatgaatggttatggaatccaatggacggtcttctaagataggg |
24404157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 173 - 244
Target Start/End: Complemental strand, 24404070 - 24404000
Alignment:
| Q |
173 |
ctgcagttccatgtttagcagtccttgaaattctattgttggggtttaccgcaatacgggcctctgtactgt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24404070 |
ctgcagttccatgtttagcagtccttgaaattctattgttgggg-ttaccgcaatacgggcctctgtactgt |
24404000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 259 - 389
Target Start/End: Complemental strand, 12131648 - 12131515
Alignment:
| Q |
259 |
tcaattgtgctgccat-tctgttcctcatgcttgtgaaatcgatcc-gatactgcacatgctatcgatgtaccatcatcgtcccttgtaaaatggctgca |
356 |
Q |
| |
|
|||||||||||||||| || || |||| ||||||||||| ||||| ||||||||| ||||||| |||| || ||||| ||| ||||||||| |||| |
|
|
| T |
12131648 |
tcaattgtgctgccatctcggtgcctcgtgcttgtgaaaatgatcctgatactgcaaatgctattaatgtgccgtcatc---cctcgtaaaatggttgca |
12131552 |
T |
 |
| Q |
357 |
aa----taaacagaacagtactcttttcattcttctc |
389 |
Q |
| |
|
|| ||||||||||||||||||| |||||| |||| |
|
|
| T |
12131551 |
aagctttaaacagaacagtactcttctcattcatctc |
12131515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 35846434 - 35846368
Alignment:
| Q |
18 |
tgaagaaccttccatgcttgctctatgaatggttatggaatccaatggacggtcttctaagataggg |
84 |
Q |
| |
|
|||||| || ||||| | |||||||||||||| ||| |||||||| |||| ||||||| |||||||| |
|
|
| T |
35846434 |
tgaagacccctccatacctgctctatgaatggctattgaatccaagggactgtcttcttagataggg |
35846368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University