View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8418_high_4 (Length: 238)

Name: NF8418_high_4
Description: NF8418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8418_high_4
NF8418_high_4
[»] chr7 (1 HSPs)
chr7 (10-220)||(683562-683772)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 683562 - 683772
Alignment:
10 gtgagaagaatgttagtatatctttagctggtcatagcatgggaagtgctttagctattttacttgcttatgatatttcagagctaggtttaaacnnnnn 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         
683562 gtgagaagaatgttagtatatctttagctggtcatagcatgggaagtgctttagctattttacttgcttatgatatttcagagctaggtttaaacaaaaa 683661  T
110 nnntgataaaaatgatgccagtgttacagttttttcatttggaggacctagggttggtaacttagagtttnnnnnnngatgtgaagagttaggtgtgaaa 209  Q
       ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||       |||||||||||||||||||||||    
683662 aaatgacaaaaatgatgctagtgttacagtattttcatttggaggaccaagggttggtaacttagagtttaaaaaaagatgtgaagagttaggtgtgaaa 683761  T
210 gtgttgagaat 220  Q
    |||||||||||    
683762 gtgttgagaat 683772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University