View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8418_low_3 (Length: 314)
Name: NF8418_low_3
Description: NF8418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8418_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 41077083 - 41076785
Alignment:
| Q |
1 |
tttaacaactcacaactactctaatttttctttattctatatcctaacaggtctggactctgttaccattgaagacggctccggtttagtcagaacagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077083 |
tttaacaactcacaactactctaatttttctttattctatatcctaacaggtctggactctgttaccattgaagacggctccggtttagtcagaacagaa |
41076984 |
T |
 |
| Q |
101 |
cgcactggttccactcacctctgtaccccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataacttaatctcaaattttggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41076983 |
cgcactggttccactcacctctgtaccccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataacttaatctcaaattttggt |
41076884 |
T |
 |
| Q |
201 |
agcagaatattgtgtgttgaatttcacccattttcttttctgagaatgatctcaaaacnnnnnnncaatgttgatgcacggtccaagtaatggtaacctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41076883 |
agcagaatattgtgtgttgaatttcacccattttcttttctgagaatgatctcaaaac-ggggggcaatgttgatgcacggtccaagtaatggtaacctt |
41076785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University