View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8418_low_5 (Length: 240)
Name: NF8418_low_5
Description: NF8418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8418_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 41077214 - 41077444
Alignment:
| Q |
1 |
tagcaacatggtgactggaaccaatattttgtaatgtcctggaaattaaagtcacagttggcagtggatggtttgattgagagttgcaatgtctcgatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077214 |
tagcaacatggtgactggaaccaatattttgtaatgtcctggaaattaaagtcacagttggcagtggatggtttgattgagagttgcaatgtctcgatct |
41077313 |
T |
|
| Q |
101 |
ttgatagaaagagcgatgttgagtatgac--------agcccttatgacttccctacagttctttagggacatcaaatgagtccgagatagatttgcata |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077314 |
ttgatagaaagagcgatgttgagtatgacattttgagagcccttatgacttccctacagttctttagggacatcaaatgagtccgagatagatttgcata |
41077413 |
T |
|
| Q |
193 |
tttgacctcaatgggcttccatatttggcag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41077414 |
tttgacctcaatgggcttccatatttggcag |
41077444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 151 - 204
Target Start/End: Complemental strand, 50191530 - 50191477
Alignment:
| Q |
151 |
gttctttagggacatcaaatgagtccgagatagatttgcatatttgacctcaat |
204 |
Q |
| |
|
|||||| |||||||||| |||||||||| || |||||||||||||| ||||||| |
|
|
| T |
50191530 |
gttcttcagggacatcacatgagtccgatatggatttgcatatttggcctcaat |
50191477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University