View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8418_low_7 (Length: 238)
Name: NF8418_low_7
Description: NF8418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8418_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 683562 - 683772
Alignment:
| Q |
10 |
gtgagaagaatgttagtatatctttagctggtcatagcatgggaagtgctttagctattttacttgcttatgatatttcagagctaggtttaaacnnnnn |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
683562 |
gtgagaagaatgttagtatatctttagctggtcatagcatgggaagtgctttagctattttacttgcttatgatatttcagagctaggtttaaacaaaaa |
683661 |
T |
 |
| Q |
110 |
nnntgataaaaatgatgccagtgttacagttttttcatttggaggacctagggttggtaacttagagtttnnnnnnngatgtgaagagttaggtgtgaaa |
209 |
Q |
| |
|
||| ||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
683662 |
aaatgacaaaaatgatgctagtgttacagtattttcatttggaggaccaagggttggtaacttagagtttaaaaaaagatgtgaagagttaggtgtgaaa |
683761 |
T |
 |
| Q |
210 |
gtgttgagaat |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
683762 |
gtgttgagaat |
683772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University